Accession number

Results: 285



#Item
131Molecular biology / Nucleic acids / Science / DNA Data Bank of Japan / Genomics / International Nucleotide Sequence Database Collaboration / Accession number / GenBank / Nucleic acid sequence / Biology / Bioinformatics / Biological databases

DDBJ Web Magazine-e No.75 & 76 | DDBJ

Add to Reading List

Source URL: www.ddbj.nig.ac.jp

Language: English - Date: 2014-09-09 03:17:55
132Science / Molecular biology / Nucleic acids / DNA Data Bank of Japan / Genomics / Accession number / Bioinformatics / Biology / Biological databases

DDBJ Mail Magazine No.68, 69 & 70 | DDBJ

Add to Reading List

Source URL: www.ddbj.nig.ac.jp

Language: English - Date: 2014-09-09 03:17:49
133American atheists / Genome projects / Biological databases / Molecular biology / DNA Data Bank of Japan / Accession number / Craig Venter / Global Ocean Sampling Expedition / Community Cyberinfrastructure for Advanced Marine Microbial Ecology Research and Analysis / Biology / Bioinformatics / Science

DDBJ mail magazine [November 13, 2007]

Add to Reading List

Source URL: www.ddbj.nig.ac.jp

Language: English - Date: 2014-09-09 03:17:30
134Biology / Molecular biology / Nucleic acids / Patent offices / DNA Data Bank of Japan / International Nucleotide Sequence Database Collaboration / Sequence Read Archive / Accession number / Takashi Gojobori / Biological databases / Bioinformatics / Science

DDBJ Mail Magazine No.66 & 67 | DDBJ

Add to Reading List

Source URL: www.ddbj.nig.ac.jp

Language: English - Date: 2014-09-09 03:17:47
135Cultural studies / Collection / Museum / Type / Accession number / Curator / Museology / Science / Humanities

Curatorial Responsibilities for Researchers.indd

Add to Reading List

Source URL: www.nps.gov

Language: English - Date: 2009-11-09 20:32:43
136

Gene Name Mature host-defence peptide name Uniprot Accession Number CATHL1 Bactenecin (Bac)1, cyclic dodecapeptide P22226

Add to Reading List

Source URL: t-stor.teagasc.ie

Language: English - Date: 2014-10-10 21:01:23
    137

    Additional file 1 Table S1. Bovine oligonucleotide primers used for qPCR Gene Symbol Primers (5’ to 3’) Product[removed]size Efficiency1 Accession Number Nucleoside transporters SLC28A1 F: AGAAGTGAGGAAGGCGTGAA

    Add to Reading List

    Source URL: t-stor.teagasc.ie

    Language: English - Date: 2014-10-22 21:01:38
      138Computational phylogenetics / Biological databases / Model organisms / Molecular biology / DNA Data Bank of Japan / International Nucleotide Sequence Database Collaboration / FASTA format / Takashi Gojobori / Accession number / Bioinformatics / Science / Biology

      DDBJ mail magazine [March 2007]

      Add to Reading List

      Source URL: www.ddbj.nig.ac.jp

      Language: English - Date: 2014-09-09 03:17:28
      139DNA Data Bank of Japan / Sequence Read Archive / Accession number / FASTQ format / BLAST / File Transfer Protocol / RefSeq / Bioinformatics / Science / Biological databases

         Site Search HOME Submission

      Add to Reading List

      Source URL: www.ddbj.nig.ac.jp

      Language: English - Date: 2014-09-09 03:17:40
      140Biology / UniProt / Sequence Read Archive / Accession number / DNA Data Bank of Japan / File Transfer Protocol / Bioinformatics / Biological databases / Science

         Site Search HOME Submission

      Add to Reading List

      Source URL: www.ddbj.nig.ac.jp

      Language: English - Date: 2014-09-09 03:17:38
      UPDATE